Category Archives: IA

IA, ChatGPT

How to Create Ghibli Style Images with ChatGPT for Free

Studio Ghibli is known for its breathtaking hand-drawn animation and unique art style that combines soft colors, detailed backgrounds, and expressive characters. If you’ve ever wanted to create Ghibli-style images without expensive software or artistic skills, you’re in luck! With ChatGPT and AI-powered tools, you can generate stunning Ghibli-inspired artwork for free.

Step 1: Accessing ChatGPT’s Image Generation Tool

To create Ghibli-style images, you need access to an AI image-generation tool powered by ChatGPT, such as OpenAI’s DALL·E model. Here’s how you can use it for free:

  1. Visit ChatGPT (chat.openai.com) – If you don’t have an account, sign up for a free one.
  2. Navigate to the Image Generator – Depending on availability, OpenAI provides an image generation tool integrated with ChatGPT.
  3. Use the Right Prompt – AI-generated images rely heavily on well-crafted prompts.
  4. Upload Your Own Image – If you already have an image, you can upload it to ChatGPT and use a simple prompt like: “Transform my image into Ghibli style.”

How to make Ghibli Art in Chat Gpt FREE | Create Unlimited Images

Step 2: Crafting the Perfect Ghibli-Style Prompt

To get the best results, describe the scene clearly while focusing on the Ghibli art style. Here’s an example of a prompt:

“A peaceful Japanese village in the countryside during sunset, drawn in Studio Ghibli style. The houses have wooden frames and paper lanterns glowing softly. A young girl with short hair and a red dress runs along a stone path, surrounded by lush green fields and cherry blossom trees. The sky has warm orange hues with fluffy clouds.”

Tips for a better prompt:

  • Specify the art style: Use terms like Ghibli-style, hand-drawn, anime-inspired, soft lighting, watercolor textures.
  • Describe emotions and ambiance: Ghibli films have a magical, nostalgic feel.
  • Mention characters: Describe their outfit, expressions, and actions.

Step 3: Enhancing Your AI-Generated Image

Once the AI generates your image, you can improve it with free tools:

  • Run it through an AI Upscaler: Websites like Let’s Enhance or Upscale.media can improve image resolution.
  • Refine with Photoshop or GIMP: Adjust colors or add small details manually.
  • Use Filters: Apps like Snapseed or Canva offer anime-style filters to enhance the Ghibli effect.

Step 4: Bringing Your Ghibli World to Life

If you want to create a full animation or interactive scene:

  • Use Canva or Clip Studio Paint to animate slight movements.
  • Try AI-powered animation tools like Runway ML to add motion.
  • Combine images into a storyboard for storytelling.

Conclusion

Creating Ghibli-style images with ChatGPT is easier than ever, thanks to AI-powered tools. With a bit of creativity and the right prompts, you can generate stunning Ghibli-inspired art for free. Try experimenting with different prompts and tools to refine your artwork. Who knows? Your AI-generated Ghibli world could inspire your next creative project!

Post Views: 173
IA

Comment Créer des Images Style Studio Ghibli avec ChatGPT ?

Le Studio Ghibli, célèbre pour ses films enchanteurs comme Le Voyage de Chihiro et Mon Voisin Totoro, inspire des millions de fans à travers le monde. Grâce à l’intelligence artificielle, il est désormais possible de générer des images dans son style unique gratuitement avec ChatGPT et DALL·E. Une récente collaboration entre OpenAI et le Studio Ghibli rend cette expérience encore plus fidèle à l’univers visuel du studio japonais.

Accéder à la Création d’Images Ghibli sur ChatGPT

Pour générer des images, deux options principales s’offrent à vous :

  • Version gratuite (DALL·E 3) : Disponible via ChatGPT (GPT-4o), elle permet de créer des visuels inspirés de Ghibli avec les bonnes instructions.
  • Mode “Style Ghibli” (via accord officiel) : Une option plus avancée pour des rendus authentiques, disponible sur les versions premium de ChatGPT.

Écrire un Prompt Efficace pour un Style Ghibli Réussi

La qualité de l’image dépend en grande partie de la précision de votre description. Voici les éléments clés à inclure :

Mots-clés Indispensables

  • “Style Studio Ghibli” ou “Esthétique Hayao Miyazaki”
  • “Aquarelle douce, couleurs pastel, lumière chaleureuse”
  • “Ambiance magique, onirique, nostalgique”

Exemples de Prompts

1. “Une forêt enchantée peuplée d’esprits forestiers, style Studio Ghibli, aquarelle, tons verts et dorés, atmosphère mystérieuse mais apaisante.”

2. “Une ville flottante avec des machines à vapeur, inspirée de Le Château dans le Ciel, style Ghibli officiel, couleurs pastel, ciel nuageux.”

Affiner et Améliorer Vos Créations

  • Précision des détails : Plus votre description est détaillée, meilleur sera le résultat. Mentionnez des références à des films spécifiques comme Totoro ou Princesse Mononoké.
  • Ajustements : Si le résultat ne correspond pas à vos attentes, modifiez légèrement la description en ajoutant des indications comme “plus de flou artistique” ou “des ombres plus douces”.
  • Retouches optionnelles : Des outils comme Photoshop ou GIMP peuvent aider à peaufiner les couleurs et les textures.

Limitations et Règles à Connaître

  • Usage non commercial : Les images générées ne peuvent pas être vendues ou utilisées dans des projets commerciaux en raison des droits du Studio Ghibli.
  • Personnages existants : L’IA ne reproduira pas les personnages emblématiques comme Totoro ou Calcifer pour éviter les problèmes de copyright.
  • Accès premium : L’option officielle “Style Ghibli” pourrait nécessiter un abonnement ChatGPT Plus.

Pourquoi Cette Collaboration OpenAI-Ghibli est Importante ?

Le Studio Ghibli, reconnu pour son approche artisanale et traditionnelle de l’animation, marque un tournant en s’associant à l’intelligence artificielle. Cette collaboration ouvre de nouvelles possibilités pour :

  • Les fans qui souhaitent explorer leur propre univers inspiré de Ghibli.
  • Les artistes en quête d’inspiration pour leurs projets personnels.
  • Les amateurs de technologie intéressés par l’évolution de l’IA dans le domaine créatif.

Conclusion

Avec ChatGPT et DALL·E, les fans du Studio Ghibli peuvent désormais donner vie à leurs propres visions oniriques. Que ce soit pour le plaisir ou l’inspiration, cette technologie offre un nouveau moyen d’interagir avec l’esthétique unique de Ghibli.

Et vous, quelle scène Ghibli aimeriez-vous recréer ? Partagez vos idées en commentaires.

Mots-clés SEO : Images Studio Ghibli IA, ChatGPT Ghibli, générer art Ghibli gratuit, prompt DALL·E Studio Ghibli, accord OpenAI Ghibli

À lire aussi :

  • Les meilleurs outils IA pour artistes en 2024
  • Comment Netflix utilise l’IA dans l’animation

 

Post Views: 394
IA

DeepSeek vs. ChatGPT : l’app d’IA chinoise en tête des téléchargements

En janvier 2025, la startup chinoise DeepSeek a marqué une étape importante avec le lancement de DeepSeek-R1, un modèle d’intelligence artificielle open-source qui, selon l’agence de presse Xinhua, représente une avancée majeure en matière de raisonnement autonome. Cette annonce a secoué l’industrie de l’IA, rivalisant directement avec les leaders du secteur tels qu’OpenAI et ses modèles de référence.

Des Caractéristiques Innovantes

L’une des caractéristiques notables de DeepSeek-R1 réside dans l’utilisation de techniques avancées, notamment la chaîne de pensée (CoT), qui améliore les capacités de raisonnement du modèle. Ces techniques permettent à l’IA de développer un raisonnement plus fluide et plus nuancé, donnant à DeepSeek-R1 un avantage sur ses concurrents dans des domaines cruciaux comme les mathématiques, la programmation et le raisonnement en langage naturel.

Le modèle a été formé sur un vaste corpus de données, incluant environ 14,8 milliards de jetons (unités de texte ayant une signification pour un modèle de langage). Cela lui confère une compréhension approfondie du langage et des nuances contextuelles, l’aidant à résoudre des problèmes complexes avec une précision surprenante.




 

Performances Égalant les Leaders

Selon les affirmations de la société chinoise, DeepSeek-R1 affiche des performances comparables à celles des géants de l’industrie, tels qu’OpenAI, dans des domaines variés allant des calculs mathématiques à l’analyse du langage naturel. L’IA excelle non seulement en termes de résultats, mais elle se distingue également par son coût d’utilisation extrêmement abordable, ce qui attire de nombreux développeurs et entreprises.

Impact sur les Marchés Financiers

Cette percée technologique n’a pas seulement eu un impact sur l’industrie, mais elle a également perturbé les marchés financiers. Dès l’ouverture de la bourse lundi, les actions liées à DeepSeek ont enregistré une forte hausse, avec plusieurs titres ayant gagné plus de 10%. Cette augmentation illustre la confiance croissante des investisseurs dans la capacité de la startup à se positionner comme un acteur majeur sur la scène mondiale.




L’Ambition de la Chine : Devenir le Leader de l’IA d’ici 2030

Ce succès s’inscrit dans une stratégie plus large de la Chine visant à devenir le leader mondial de l’intelligence artificielle d’ici 2030. Le gouvernement chinois a prévu des investissements massifs dans l’IA, se chiffrant en dizaines de milliards de dollars dans les années à venir. Cette ambition est renforcée par des entreprises comme DeepSeek, qui montrent le potentiel de l’innovation chinoise dans le domaine de l’IA.

En somme, DeepSeek-R1 est une avancée technologique remarquable qui défie les leaders de l’IA avec des performances comparables à celles d’OpenAI, tout en offrant un modèle économique plus accessible. Alors que la Chine continue d’investir massivement dans l’intelligence artificielle, DeepSeek pourrait bien être un acteur clé dans la prochaine révolution technologique.

Post Views: 164
IA

Chinese AI Chatbot DeepSeek Disrupts the Industry

The Chinese AI chatbot DeepSeek has caused waves in the market with its groundbreaking claims. Powered by the open-source DeepSeek-V3 model, the chatbot was reportedly developed for under $6 million (£7.5m)—a fraction of the billions invested by its global competitors. However, this figure has been met with skepticism by others in the AI community.

Innovation Through Open Source

According to its researchers, DeepSeek leverages existing technologies and open-source code—freely accessible software that can be modified or distributed by anyone. This approach has significantly reduced costs and demonstrated the potential of developing AI models on a tighter budget.




A Response to US Export Restrictions

DeepSeek’s rise comes amid growing tensions between the US and China, particularly regarding the restriction of advanced chip technology essential for powering AI systems. In response, Chinese AI developers have adopted innovative methods, sharing resources and exploring new approaches to reduce dependency on imported chips.

These efforts have led to AI models that require substantially less computing power than before. Not only do these models lower costs, but they also challenge traditional industry assumptions, potentially reshaping the competitive landscape.

The Founder of DeepSeek

DeepSeek was founded in 2023 by Liang Wenfeng, a graduate in information and electronic engineering, in the city of Hangzhou, southeastern China. Mr. Liang is also the founder of a hedge fund that financed DeepSeek’s development.

Before the US export ban on Nvidia A100 chips, Mr. Liang reportedly stockpiled an estimated 50,000 units of the high-performance processors. By combining these with more affordable, lower-end chips still available for import, he successfully launched DeepSeek.

 




A Rising Industry Leader

Mr. Liang’s work has brought him to the forefront of China’s AI development. He was recently seen at a high-profile meeting with Chinese Premier Li Qiang, discussing advancements in AI technology.

In a July 2024 interview with The China Academy, Mr. Liang expressed his surprise at the reaction to an earlier version of the DeepSeek AI model, which had already demonstrated significant potential.

A New Era for AI Development

DeepSeek’s emergence underscores the ingenuity and adaptability of Chinese AI developers amid challenging circumstances. By prioritizing cost-effective solutions and collaboration, they are not only defying limitations but also driving innovation in the global AI industry.

Post Views: 63
IA

Les 50 Outils d’IA Générative les Plus Utilisés en Septembre 2024

Les logiciels d’IA générative se développent de plus en plus rapidement ! En septembre 2024, le chatbot de base ouvert par ChatGPT d’OpenAI reste le logiciel d’IA générative le plus populaire et le plus performant : Quelques points à retenir ce mois-ci : ChatGPT continue à être en tête, avec de près le suivi de Character.ai pour la génération de personnages de réalité virtuelle (VR) et Perplexity pour la plupart des utilisations avancées pour la recherche. Claude passe à la 4 e position ce mois-ci, seulement quelques mois après le lancement de sa fonctionnalité `Artifacts`, en février. Il en est de même de Luma AI, qui atteint même la 14 e place. Gemini devait être le concurrent du ChatGPT. Pour autant, le.produit n’est plus glUniform

1. ChatGPT Maintient sa Position de Leader

ChatGPT d’OpenAI reste le champion incontesté parmi les outils d’IA générative. Sa flexibilité et ses capacités étendues continuent d’attirer une large base d’utilisateurs, consolidant ainsi sa position en tête du classement.

2. Claude : Une Ascension Remarquable

Depuis son arrivée en 10e position en mars, Claude a fait une montée spectaculaire. Aujourd’hui, il se classe au quatrième rang, surtout grâce à sa nouvelle fonctionnalité Artifacts, lancée en février. Cette évolution rapide témoigne de son impact croissant sur le marché.

3. Character.ai et Perplexity : Les Nouveaux Challengers

Sur le podium, Character.ai se distingue pour sa création de personnages virtuels captivants, tandis que Perplexity brille dans le domaine de la recherche. Ces outils complètent le trio de tête avec des fonctionnalités innovantes qui captivent les utilisateurs.




Les changements sont minimes en se qui concerne le classement mobile; ChatGPT,Microsoft Edge et Photomath restent les leaders de la croissance là-bas. Quant à Claude, bien qu’il soit récemment venu sur Android, il n’a pas encore grimpé dans le top mobile, tandis que Character.ai occupe désormais la 10e place, gagnant six places du 16e rang. Copilot de Microsoft, qui s’appelait autrefois Bing Chat, a attiré un public plus important et est passé de langui en 37e place, tandis que Bing restait fort, assis en 5e place. Il s’avère que le rebranding de Microsoft pour construire son entreprise en un seul mot et un logo en 2023 ne correspondait pas complètement à la résonance des utilisateurs. Pour en savoir plus sur le terrain et les outils générationnels de l’IA, consultez les participants actuels.

4. La Départ de Gemini du Top 50

Malgré un lancement prometteur, Gemini de Google ne parvient plus à se maintenir dans le top 50. Cependant, Google ne baisse pas les bras et continue de perfectionner ses chatbots personnalisés et son générateur d’images sur Gemini.

5. Mobile : Un Classement Stable avec Quelques Changements

Sur mobile, le classement reste relativement stable. ChatGPT, Microsoft Edge, et Photomath dominent toujours. Claude, malgré son lancement récent sur Android, n’a pas encore réussi à se faire une place dans le top mobile. En revanche, Character.ai a fait un bond significatif, passant de la 16e à la 10e place.

6. Copilot et Bing : Quelques Évolutions

Copilot, le chatbot de Microsoft anciennement connu sous le nom de Bing Chat, se classe maintenant à la 36e position, avec une légère progression. En revanche, Bing conserve une solide 5e place, bien que le rebranding de Microsoft en novembre 2023 semble encore en cours d’intégration par les utilisateurs.

 

Post Views: 48
IA, ChatGPT

How To Use GPT-4o : Complete Guide With Tips and Tricks

GPT-4o: Transforming AI Landscape with Enhanced Accessibility and Innovation




In the dynamic sphere of artificial intelligence, OpenAI’s latest revelation, GPT-4o, represents a monumental leap towards advancing AI accessibility and fostering innovation. Unveiled amidst great anticipation during a landmark press conference on May 13, 2024, GPT-4o emerges as the epitome of OpenAI’s esteemed Generative Pre-trained Transformer series, equipped with unparalleled capabilities in voice and visual processing. As it sets new benchmarks for natural language understanding and generation, GPT-4o not only democratizes access to cutting-edge AI technology but also ushers in a new era of inclusivity and innovation on a global scale.

Introduction to GPT-4o: Pioneering the Next Wave of AI Evolution

GPT-4o, distinguished by its “omnimodel” designation, signifies a quantum leap in AI technology. The term “omnimodel” encapsulates its multifaceted nature, enabling seamless processing across an array of formats spanning text, voice, and images. At the press conference, OpenAI unveiled GPT-4o’s remarkable speed and performance, surpassing its predecessors with unprecedented efficiency and precision. Crucially, GPT-4o’s availability to all users underscores OpenAI’s steadfast commitment to democratizing AI and fostering inclusivity in the digital age.

Advancements and Future Prospects

Looking towards the horizon, GPT-4o holds boundless promise for future applications. OpenAI has hinted at plans to augment its capabilities to support video formats, including real-time video analysis. Moreover, the model’s potential to facilitate natural, real-time voice interactions represents a significant breakthrough in conversational AI. Picture a future where users can seamlessly engage with ChatGPT through live video feeds, unlocking endless interactive possibilities and reshaping the landscape of human-machine interactions.




Unrivaled Performance in Voice Recognition and Image Analysis

Technical evaluations underscore GPT-4o’s superiority in voice recognition and image analysis. Compared to its predecessors, GPT-4o boasts significantly lower error rates in speech processing, ensuring heightened accuracy and reliability. Additionally, its advanced visual processing capabilities have garnered acclaim for their ability to generate and iterate visuals with unparalleled precision, empowering users to express creativity and tackle complex problems with unprecedented ease.

Accessibility and Integration Across Subscription Tiers

OpenAI’s proactive efforts ensure equitable access to GPT-4o across diverse subscription tiers. While premium plan subscribers like ChatGPT Plus and Team already benefit from access to the model, Enterprise plan subscribers can anticipate seamless integration in the near future. Furthermore, GPT-4o’s availability in the free version of ChatGPT, albeit with tailored message limits, ensures widespread accessibility and inclusivity, reinforcing OpenAI’s commitment to democratizing AI technology for all.

Exploring Advanced Features with ChatGPT




The integration of GPT-4o into ChatGPT’s free version signifies a significant stride towards democratizing AI accessibility. Users now have the opportunity to explore a myriad of advanced AI functionalities, including web access, data analysis, image processing, and custom chatbots. By selecting GPT-4o from the interface menu, users can unlock a treasure trove of features previously reserved for premium plans, empowering them to leverage cutting-edge AI capabilities in their daily interactions and fostering a culture of innovation and collaboration.

Testing the new Chat GPT 4o

Click here to try new CHATGPT 4o

How To Use GPT-4o (GPT4o Tutorial) Complete Guide With Tips and Tricks

Embracing the Future of AI

As GPT-4o permeates various facets of our lives, it heralds a new epoch of AI accessibility and innovation. With its advanced capabilities and seamless integration, GPT-4o empowers users to harness the full potential of AI technology, driving progress and transformation across diverse industries. As organizations and individuals embrace this groundbreaking model, the possibilities for innovation and collaboration are boundless, ushering in a future where AI enriches and empowers lives in unprecedented ways.

Post Views: 94
IA

Download InstaDeepAI/nucleotide-transformer-v2-500m-multi-species

The Nucleotide Transformers represent a series of fundamental language models initially trained on DNA sequences sourced from entire genomes. Diverging from conventional methods, our models not only assimilate data from individual reference genomes but also harness DNA sequences extracted from more than 3,200 varied human genomes and 850 genomes spanning a broad spectrum of species, encompassing both model and non-model organisms. Rigorous and comprehensive evaluations demonstrate that these expansive models yield exceptionally precise predictions of molecular phenotypes, surpassing current methodologies.

Within this assemblage lies the nucleotide-transformer-v2-500m-multi-species model, boasting 500 million parameters and trained on a compilation of 850 genomes sourced from a diverse array of species, encompassing both model and non-model organisms.

Developed by: InstaDeep, NVIDIA and TUM



 

Model Sources

How to use

Until its next release, the transformers library needs to be installed from source with the following command in order to use the models:

pip install --upgrade git+https://github.com/huggingface/transformers.git

 

A small snippet of code is given here in order to retrieve both logits and embeddings from a dummy DNA sequence.

from transformers import AutoTokenizer, AutoModelForMaskedLM
import torch

# Import the tokenizer and the model
tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/nucleotide-transformer-v2-500m-multi-species", trust_remote_code=True)
model = AutoModelForMaskedLM.from_pretrained("InstaDeepAI/nucleotide-transformer-v2-500m-multi-species", trust_remote_code=True)

# Choose the length to which the input sequences are padded. By default, the 
# model max length is chosen, but feel free to decrease it as the time taken to 
# obtain the embeddings increases significantly with it.
max_length = tokenizer.model_max_length

# Create a dummy dna sequence and tokenize it
sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
tokens_ids = tokenizer.batch_encode_plus(sequences, return_tensors="pt", padding="max_length", max_length = max_length)["input_ids"]

# Compute the embeddings
attention_mask = tokens_ids != tokenizer.pad_token_id
torch_outs = model(
    tokens_ids,
    attention_mask=attention_mask,
    encoder_attention_mask=attention_mask,
    output_hidden_states=True
)

# Compute sequences embeddings
embeddings = torch_outs['hidden_states'][-1].detach().numpy()
print(f"Embeddings shape: {embeddings.shape}")
print(f"Embeddings per token: {embeddings}")

# Add embed dimension axis
attention_mask = torch.unsqueeze(attention_mask, dim=-1)

# Compute mean embeddings per sequence
mean_sequence_embeddings = torch.sum(attention_mask*embeddings, axis=-2)/torch.sum(attention_mask, axis=1)
print(f"Mean sequence embeddings: {mean_sequence_embeddings}")

 

Training data

The nucleotide-transformer-v2-500m-multi-species model was pretrained on a total of 850 genomes downloaded from NCBI. Plants and viruses are not included in these genomes, as their regulatory elements differ from those of interest in the paper’s tasks. Some heavily studied model organisms were picked to be included in the collection of genomes, which represents a total of 174B nucleotides, i.e roughly 29B tokens. The data has been released as a HuggingFace dataset here.

Training procedure

Preprocessing

The DNA sequences are tokenized using the Nucleotide Transformer Tokenizer, which tokenizes sequences as 6-mers tokenizer when possible, otherwise tokenizing each nucleotide separately as described in the Tokenization section of the associated repository. This tokenizer has a vocabulary size of 4105. The inputs of the model are then of the form:

<CLS> <ACGTGT> <ACGTGC> <ACGGAC> <GACTAG> <TCAGCA>

 

The tokenized sequence have a maximum length of 1,000.

The masking procedure used is the standard one for Bert-style training:

  • 15% of the tokens are masked.
  • In 80% of the cases, the masked tokens are replaced by [MASK].
  • In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
  • In the 10% remaining cases, the masked tokens are left as is.

Pretraining

The model was trained with 8 A100 80GB on 900B tokens, with an effective batch size of 1M tokens. The sequence length used was 1000 tokens. The Adam optimizer [38] was used with a learning rate schedule, and standard values for exponential decay rates and epsilon constants, β1 = 0.9, β2 = 0.999 and ε=1e-8. During a first warmup period, the learning rate was increased linearly between 5e-5 and 1e-4 over 16k steps before decreasing following a square root decay until the end of training.

Architecture

The model belongs to the second generation of nucleotide transformers, with the changes in architecture consisting the use of rotary positional embeddings instead of learned ones, as well as the introduction of Gated Linear Units.

BibTeX entry and citation info

@article{dalla2023nucleotide,
  title={The Nucleotide Transformer: Building and Evaluating Robust Foundation Models for Human Genomics},
  author={Dalla-Torre, Hugo and Gonzalez, Liam and Mendoza Revilla, Javier and Lopez Carranza, Nicolas and Henryk Grywaczewski, Adam and Oteri, Francesco and Dallago, Christian and Trop, Evan and Sirelkhatim, Hassan and Richard, Guillaume and others},
  journal={bioRxiv},
  pages={2023--01},
  year={2023},
  publisher={Cold Spring Harbor Laboratory}
}

 

Post Views: 49
ChatGPT, IA

openai sora text to video

In a world where technology continues to break barriers and redefine boundaries, OpenAI once again stands at the forefront of innovation with the introduction of Sora Text-to-Video. This groundbreaking advancement in artificial intelligence seamlessly integrates text-based narratives with visually captivating video content, revolutionizing the way stories are told and experienced.

Imagine a world where the power of words is not confined to the pages of a book or the pixels of a screen, but instead brought to life through dynamic, lifelike visuals. Sora Text-to-Video makes this vision a reality by transforming written text into immersive video narratives, complete with vibrant characters, stunning landscapes, and captivating scenes.




At its core, Sora utilizes cutting-edge natural language processing algorithms to analyze and understand the intricacies of written text. By deciphering the nuances of language, Sora is able to extract key elements such as characters, settings, emotions, and plot points, laying the foundation for the creation of visually compelling videos.

One of the most remarkable aspects of Sora is its ability to generate highly realistic animations that closely mimic human movements and expressions. Through advanced machine learning techniques, Sora imbues characters with a sense of life and personality, allowing viewers to form deep emotional connections with the stories being told.

But Sora Text-to-Video is more than just a tool for entertainment—it has the potential to revolutionize a wide range of industries, from education and marketing to film production and beyond. Imagine using Sora to bring historical events to life in the classroom, allowing students to immerse themselves in pivotal moments from the past. Or envision using Sora to create personalized advertising campaigns that resonate with consumers on a deeper level than ever before.

Furthermore, Sora has the power to democratize storytelling by providing a platform for voices that have traditionally been underrepresented in mainstream media. By allowing anyone with a story to tell to easily create high-quality video content, Sora has the potential to usher in a new era of diversity and inclusivity in storytelling.

Watch openai sora text to video

Of course, with any new technology comes questions about ethics and responsibility. As Sora continues to evolve and become more sophisticated, it will be essential to ensure that it is used in ways that benefit society as a whole. This includes addressing concerns about privacy, misinformation, and the potential for misuse of this powerful tool.

OpenAI Sora Text-to-Video represents a bold leap forward in the realm of artificial intelligence and storytelling. By seamlessly blending the power of language with the visual richness of video, Sora has the potential to transform how we communicate, educate, and entertain. As we stand on the cusp of this exciting new frontier, one thing is clear: the future of storytelling has never looked brighter.







Post Views: 60
IA

Video : Bill Gates is optimistic about the future of AI

This year was the first time I used artificial intelligence for work, and not just for the novelty.
I suspect it’s the same for many people.
We are now at the beginning of a major technological transition.
We live in exciting and confusing times, full of uncertainty about how AI will shape the coming years, but it’s clearer than ever how AI can be used to improve productivity and scale productivity, access to education, mental health care and more.

My work is always linked to one central idea: Innovation is the key to progress.
That’s why I founded Microsoft.
That’s why Melinda and I founded the Gates Foundation more than 20 years ago.
And that’s why life around the world has improved so much over the past century.
Since 2000, the world has almost halved the number of children who die before the age of five – and innovation is the main reason.
Scientists have found new ways to make vaccines faster and cheaper while still being safe.
They have developed new delivery mechanisms that work in the most remote places in the world, reaching more children and creating new vaccines that protect children against deadly diseases like rotavirus .
In a world of limited resources, you must find ways to maximize impact.
Innovation is key to getting the most out of every dollar spent.

And AI is poised to accelerate new discoveries at a pace never seen before.
By far, one of the biggest impacts has involved the creation of new drugs.
AI tools can significantly speed up the drug development process, and several companies are already working on cancer drugs developed this way.
One of the Gates Foundation’s key AI priorities is ensuring that these tools are also used to fight health problems such as AIDS, tuberculosis and malaria, which disproportionately affect the poorest people in the world.
world.

I believe there is enormous potential in using AI to improve lives in low- and middle-income countries.
I recently met several innovators from developing countries during a trip to Senegal.
They are conducting incredible AI research with the intention that one day it will benefit everyone in their community.
Much of their work is still in the early stages of development, but it is setting the stage for a major tech boom later this decade.





Bill Gates: Why I’m optimistic about the future of AI




Post Views: 45